Ctcf shrna
WebCTCF depletion in immortalised human and mouse cells using shRNA knockdown and CRISPR/Cas9 genome editing as well as examined the growth and development of heterozygous Ctcf (Ctcf +/ ) mice. WebNSD2 Low cell lines were generated in these three B-ALL cell lines because they naturally harbor a heterozygous NSD2 EK mutation. More specifically, a short-hairpin RNA (shRNA: GGAAACTACTCTCGATTTATG) was used to knockdown NSD2 targeting the NSD2 Type II and NSD2 RE-IIBP isoforms both of which contain the SET domain.
Ctcf shrna
Did you know?
WebSep 1, 2016 · Our results explain how epigenetic factor CTCF-mediated chromatin remodeling regulates interactions between eye-specific PAX6 and those genes that are induced/associated with cell differentiation to modulate corneal epithelial cell-specific differentiation. ... Diminished CTCF mRNA with CTCF-shRNA in HTCE cells weakened … WebDec 26, 2024 · Efficient CTCF knockdown and single cell RNA-seq. We knocked down CTCF in EL4 cells by short hairpin RNA (shRNA). Western blotting showed a dramatic …
WebMay 5, 2024 · Deletion of CTCF attenuated adipogenesis while overexpression enhanced adipocyte differentiation, indicating CTCF is indispensable for adipogenesis. ... Sequences of shRNA oligos can be found in Supplemental Table 1. Lentiviral vectors carrying ATF4 or CTCF cDNAs were purchased from Addgene (USA) or GeneCopoeia (China). PPARγ … WebUsing 3C-based experiments in B cells where CTCF protein levels were downregulated by shRNA-mediated CTCF depletion or Mb1-Cre-mediated conditional deletion of the Ctcf …
WebDec 26, 2024 · Results: We knocked down CTCF in EL4 cells using shRNA, and conducted single cell RNA-seq on both wild type (WT) cells and CTCF-Knockdown (CTCF-KD) cells using Fluidigm C1 system. Principal component analysis of single cell RNA-seq data showed that WT and CTCF-KD cells concentrated in two different clusters on PC1, … WebNov 30, 2024 · 2. Results. We used shRNA knockdown to model the cellular consequences of reduced CTCF expression in K562 cells. Western blots showed that CTCF protein expression was significantly knocked down by ~80% in the presence of doxycycline (dox) in sh.CTCF K562 cells compared to non dox-treated cells and sh.control cells (Figure 1 …
Web14 hours ago · All sgRNA and shRNA targeting sequences (Supplementary Tables ... the CTCF class targets were identified as sites co-occupied by 7 of 7 factors, ...
WebOct 1, 2012 · The 3C assay requires large numbers of cells in which CTCF has been knocked down, precluding the use of ex vivo pro-B cells. We therefore transduced a Rag2 −/− pro–B-cell line with retroviruses expressing control or CTCF shRNA. The cells were harvested 4 d after transduction and prepared for 3C analysis. greenpoint snipping toolWebSep 1, 2016 · In CTCF-shRNA cells, CTCF expression was further diminished and PAX6, ADAM17 and RCN1 protein expressions were enhanced following the time course. Effects of altered CTCF activity on PAX6 and PAX6-associated ADAM17 and RCN1 expression were further measured by RT-PCR in both Lv-control and CTCF-shRNA HTCE cells. greenpoint sports clubWebFeb 20, 2024 · First, we performed RNA-seq analysis to compare the expression profiles of CTCF shRNA and control shRNA transfectants (raw data accessible via GSE169451) (Figure S6A–E) and identified 2110 upregulated genes and 1908 downregulated genes ( Fold Change > 1.5, q < .05) after knockdown of CTCF in TAMs (Figure 3B). greenpoint specialised lendingWebCTCF (the CCCTC-binding factor) is a sequence-specific DNA binding protein that recognizes extended DNA motifs with its 11 zinc fingers and acts as a critical regulator of interphase genome folding (Splinter et al ... (NT) shRNA. (G) Effects of 2 h of LPS stimulation on the 7543 H3K9me3 blocks methylated by SETDB1. (H) ... fly to ballaratWebMar 8, 2024 · Depletion of endogenous CTCF in the BMDCs was confirmed at the mRNA and protein levels (Fig. 1b, c).Genome-wide CTCF binding patterns, measured by ChIP … fly to ballina from sydneyWebJun 1, 2015 · CTCF is a key regulator of nuclear chromatin structure, chromatin organization and gene regulation. The impact of CTCF on transcriptional output is quite varied, ranging from repression, to transcriptional pausing and transactivation. ... The mouse B lymphocyte cell lines Wehi-231 expressing shRNA construct Control (Wehi-CT) or a shRNA ... greenpoints storesWebshRNA sequences correspond to CTCF siRNA Gene Silencer sequences After transduction, stable cell lines expressing the shRNA may be isolated via selection with … fly to banff alberta